Probing of the betB gene from the cyanobacterium Aphanothece halophytica

Abstract

The halotolerant cyanobacterium Aphanothece halophytica synthesizes the osmoprotectant glycine betaine in response to osmotic stress when the cells were grown in high salt medium. Choline is converted to betaine aldehyde, which in turn is converted further to glycine betaine. The enzymes involved are the products of betAB genes. Three methods of selection were used to isolate betB gene from A. halophytica chromosomal DNA, namely bet phenotypic selection, colony hybridization and Southern blot hybridization. For the first two methods, the A. halophytica choromsomal DNA library was constructed by ligating the Sau3AI digested DNA into the BamHl site of pUC18 and transforming into Escherichia coli. The bet phenotype was selected on M63 agar containing 0.7 M NaCl and 1 mM choline or betaine aldehyde. The transformant containing the betB or betAB genes should be able to grow on such medium. In the colony hybridization, probe no. 4402 and 4403 were designed from the homologous sequences at the N-terminal and the C-terminal coding sequences, respectively, of the related betB of other bacteria and plants and were used as hybridization probes. The sequences of these probes were 5' TGGAACTTGGCGGTAAAA 3' and 5' GCCCCTGCGCTGGCCGCTGG 3', respectively. None of the bet genes were selected by using the above two techniques. The 0.92 kb of gbsA gene, a betB related gene, of Bacillus subtilis was finally used as a probe for Southern blot hybridization of the chromosomal DNA digested with various restriction enzymes. The hybridization bands of about 9.4-23.1 kb were observed. This suggested the extence of betB in A. halophytica chromosomal DNA.