Effects of changes in medium pH on intracellular proteins of Bradyrthizobium japonicum S76, S78 and S162

Abstract

Soils in soybean cultivation areas in the northern part of Thailand are often acidic. The soils are usually limed with commercial calcium carbonate before planting soybean seeds. The effects of the abrupt changes in soil pHs on intracellular protein profiles of indigenous Bradyrhizobium japonicum, a symbiotic nitrogen-fixer in soybean root nodules, are not known. The aim of the experiments is to simulate the agricultural practice of soil liming to determine the effects of changes of culture medium pH on intracellular protein profiles of B. japonicum. The rationale behind the experiments is changes in protein profiles upon changes in culture medium pH may lead to the elucidation of differential gene expression in B. japonicum in response to soil liming. B. japonicum S76, S78, and S162 were isolated from an acidic soil sample from Petchaboon province in the northern part of Thailand. The average soil pH of the sampling site was determined to be 5.25. RAPD-PCR fingerprinting using either RPO1 (the conserved 20-mer of nifl-IDK promoter 5'AATTTTCAAGCGTCGTGCCA3') or CRL-7 (the arbitrary GC rich primer 5'GCCCGCCGCC3') as the primer revealed that B. japonicum S76. S78 and S162 were different strains. Plant and nodule dry weights of soybeans (Glycine max) cv. Chiangmai 2 (CM 2), Chiangmai 60 (CM 60) and Sukhothai 2 (ST 2) in Leonard jars inoculated with each of the three B. japonicum strains indicated that when nitrogen-free medium pH 5.0 was used to water the soybeans, dry weights of all the three soybean cultivars were found to be lower than that of the positive control indicating that the use of the pH 5.0 nitrogen-free medium was not suitable under the experimental conditions. Duncan's Multiple Range Test showed that soybean Glycine max cv. CM 60 was suitable for growing when nitrogen-free medium pH 6.8 was used. B. japonicum S78 was found to yield higher plant dry weights for soybeans cv CM 60 and ST 2 than B. japonicum S76 and S162 when pH 5.0 nitrogen-free medium was used while at pH 6.8 B. japonicum S162 was found to yield more plant dry weight for soybean cv CM 60 than the other two strains and the positive control under the experimental conditions. When the three B. japonicum strains were grown in yeast mannitol broth (YMB) pH 4.0-9.0 with no buffer, all strains could grow at all pHs. When the strains were grown in YMB with appropriate buffers at initial pHs 4.0-9.0, the strains could not grow at pHs 4.0 and 5.0. The optimal buffered and unbuffered pH for the growth of B. japonicum S76, S78 and S162 was found to be 7.0. SDS-PAGE of intracellular soluble protein profiles were found to be similar for all the mid-log phase cells of the three strains grown in both unbuffered and buffered media. When cells of each strain were grown at pH 5.5 until mid log phase. then used as inocula for yeast mannitol broth at buffered pHs 6.0, 6.5 and 7.0. SDS-PAGE soluble protein profiles indicated that there were no changes of intracellular protein profiles in the three B. japonicum strains 12h, 18h, 24h, 3 days and 5 days after the pH shifts. One remarkable finding was the disappearance or decrease in quantity of 53 kDa polypeptide within the first 24 hours after the pH shifts in all the three B. japonicum strains possibly due to the labile nature of the protein.